cfDNAWGS ======== This function is used for processing paired/single end WGS data. .. note:: User must set Configure or pipeConfigure before using. This function provides basic processing steps, like alignment and bis correction. If you want to perform comparison process, please use cfDNAWGBS2. Parameters ~~~~~~~~~~ .. code:: python cfDNAWGBS(inputFolder=None, fastq1=None, fastq2=None, adapter1=["AGATCGGAAGAGCACACGTCTGAACTCCAGTCA"], adapter2=["AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT"], fastqcOP=None, idAdapter=True, idAdOP=None, rmAdapter=True, rmAdOP={"--qualitybase": 33, "--gzip": True}, bismarkOP={"-q": True, "--phred33-quals": True, "--bowtie2": True, "--un": True,}, dudup=True, dudupOP=None, extractMethyOP={ "--no_overlap": True, "--report": True, "--no_header": True, "--gzip": True, "--bedGraph": True, "--zero_based": True, }, methyRegion=None, CNV=False, fragProfile=False, deconvolution=False, report=False, verbose=False, box=True) - inputFolder: str, input fastq file folder path. Setting this parameter means disable fastq1 and fastq2. - fastq1: list, fastq1 files. - fastq2: list, fastq2 files. - adapter1: list, adapters for fastq1 files, if idAdapter is True, this paramter will be disabled. - adapter2: list, adapters for fastq2 files, if idAdapter is True, this paramter will be disabled. - fastqcOP: Other parameters used for fastqc, please see class "fastqc". - idAdapter: Ture or False, identify adapters or not. This module is not for single end data. - idAdOP: Other parameters used for AdapterRemoval, please see class "identifyAdapter". If idAdapter is False, this paramter will be disabled. - rmAdapter: Ture or False, remove adapters or not. - rmAdOP: Other parameters used for AdapterRemoval, please see class "adapterremoval". Default: {"--qualitybase": 33, "--gzip": True}. If rmAdapter is False, this paramter will be disabled. - bismarkOP: Other parameters used for Bismark, please see class "bismark". Default: {"-q": True, "--phred33-quals": True, "--bowtie2": True, "--un": True,}. - dudup: Ture or False, remove duplicates for bismark results or not. - dudupOP: Other parameters used for bismark_deduplicate, please see class "bismark_deduplicate". If dudup is False, this paramter will be disabled. - extractMethyOP: Other parameters used for bismark_methylation_extractor, please see class "bismark_methylation_extractor". Default: {"--no_overlap": True, "--report": True, "--no_header": True, "--gzip": True, "--bedGraph": True, "--zero_based": True,} - methyRegion: Bed file contains methylation related regions. - CNV: Compute basic CNV or not. - armCNV: Compute basic arm level CNV related values. The arm level cnv detection needs control/healthy samples, therefore only operating function "cfDNAWGS" will get no results in report. This function is designed for case control study in function cfDNAWGS2. - fragProfile: Compute basic fragProfile (long short fragement statistics) related values. This module is not for single end data. The fragProfile detection needs control/healthy samples, therefore only operating function "cfDNAWGS" will get no results in report. This function is designed for case control study in function cfDNAWGS2. - deconvolution: Compute tissue proportion for each sample or not. - report: Generate user report or not. - verbose: bool, True means print all stdout, but will be slow; False means black stdout verbose, much faster. - box: output will be a box class. that mean the the results can be specified using '.', otherwise, the results will be saved as dict. Example usage: .. code:: python from cfDNApipe import * pipeConfigure( threads=60, genome="hg19", refdir=r"path_to_genome/hg19_bismark", outdir=r"path_to_output/output", data="WGBS", type="paired", build=True, JavaMem="10g", ) res = cfDNAWGBS( inputFolder=r"path_to_fastqs", idAdapter=True, rmAdapter=True, dudup=True, CNV=True, armCNV=True, fragProfile=True, report=True, verbose=False, )