cfDNAWGBS2 ========== This function is used for case/control analysis of paired/single end WGBS data. .. note:: User must set pipeConfigure2 before using. Parameters ~~~~~~~~~~ .. code:: python cfDNAWGBS2(caseFolder=None, ctrlFolder=None, caseName=None, ctrlName=None, caseFq1=None, caseFq2=None, ctrlFq1=None, ctrlFq2=None, caseAdapter1=["AGATCGGAAGAGCACACGTCTGAACTCCAGTCA"], caseAdapter2=["AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT"], ctrlAdapter1=["AGATCGGAAGAGCACACGTCTGAACTCCAGTCA"], ctrlAdapter2=["AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT"], fastqcOP=None, idAdapter=True, idAdOP=None, rmAdapter=True, rmAdOP={"--qualitybase": 33, "--gzip": True}, bismarkOP={"-q": True, "--phred33-quals": True, "--bowtie2": True, "--un": True}, dudup=True, dudupOP=None, extractMethyOP={ "--no_overlap": True, "--report": True, "--no_header": True, "--gzip": True, "--bedGraph": True, "--zero_based": True, }, methyRegion=None, armCNV=False, CNV=False, fragProfile=False, OCF=False, report=False, verbose=False, box=True) - caseFolder: str, input case fastq file folder path. Setting this parameter means disable fastq1 and fastq2. - ctrlFolder: str, input control fastq file folder path. Setting this parameter means disable fastq1 and fastq2. - caseFq1: list, case fastq1 files. - caseFq2: list, case fastq2 files. - ctrlFq1: list, control fastq1 files. - ctrlFq2: list, control fastq2 files. - caseAdapter1: list, adapters for case fastq1 files, if idAdapter is True, this paramter will be disabled. - caseAdapter2: list, adapters control for case fastq2 files, if idAdapter is True, this paramter will be disabled. - ctrlAdapter1: list, adapters control for fastq1 files, if idAdapter is True, this paramter will be disabled. - ctrlAdapter2: list, adapters for fastq2 files, if idAdapter is True, this paramter will be disabled. - fastqcOP: Other parameters used for fastqc, please see class "fastqc". - idAdapter: Ture or False, identify adapters or not. This module is not for single end data. - idAdOP: Other parameters used for AdapterRemoval, please see class "identifyAdapter". If idAdapter is False, this paramter will be disabled. - rmAdapter: Ture or False, remove adapters or not. - rmAdOP: Other parameters used for AdapterRemoval, please see class "adapterremoval". Default: {"--qualitybase": 33, "--gzip": True}. If rmAdapter is False, this paramter will be disabled. - bismarkOP: Other parameters used for Bismark, please see class "bismark". Default: {"-q": True, "--phred33-quals": True, "--bowtie2": True, "--un": True,}. - dudup: Ture or False, remove duplicates for bismark results or not. - dudupOP: Other parameters used for bismark_deduplicate, please see class "bismark_deduplicate". If dudup is False, this paramter will be disabled. - extractMethyOP: Other parameters used for bismark_methylation_extractor, please see class "bismark_methylation_extractor". Default: {"--no_overlap": True, "--report": True, "--no_header": True, "--gzip": True, "--bedGraph": True, "--zero_based": True,} - methyRegion: Bed file contains methylation related regions. - armCNV: Compute arm level CNV or not. - CNV: Compute CNV or not. If True, CNV will be computed for 3 group: case VS reference, control VS reference, case VS control. - fragProfile: Compute basic fragProfile(long short fragement statistics) or not. This module is not for single end data. - deconvolution: Compute tissue proportion for each sample or not. - OCF: Compute OCF or not. - report: Generate user report or not. - verbose: bool, True means print all stdout, but will be slow; False means black stdout verbose, much faster. - box: output will be a box class. that mean the the results can be specified using '.', otherwise, the results will be saved as dict. Example usage: .. code:: python from cfDNApipe import * pipeConfigure2( threads=20, genome="hg19", refdir="path_to_genome/hg19_bismark", outdir="path_to_output/pipeline-WGBS-comp", data="WGBS", type="paired", JavaMem="8G", case="cancer", ctrl="normal", build=True, ) case, ctrl, comp = cfDNAWGBS2( caseFolder="path_to_fastqs/raw/case", ctrlFolder="path_to_fastqs/raw/ctrl", caseName="cancer", ctrlName="tumor", idAdapter=True, rmAdapter=True, dudup=True, armCNV=True, CNV=True, fragProfile=True, deconvolution=True, OCF=True, verbose=True, )