cfDNAWGBS ========= This function is used for processing paired/single end WGBS data. .. note:: User must set Configure or pipeConfigure before using. This function provides basic processing steps, like alignment and bis correction. If you want to perform comparison process, please use cfDNAWGBS2. Parameters ~~~~~~~~~~ .. code:: python cfDNAWGS(inputFolder=None, fastq1=None, fastq2=None, adapter1=["AGATCGGAAGAGCACACGTCTGAACTCCAGTCA"], adapter2=["AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT"], fastqcOP=None, idAdapter=True, idAdOP=None, rmAdapter=True, rmAdOP={"--qualitybase": 33, "--gzip": True}, bowtie2OP={"-q": True, "-N": 1, "--time": True}, dudup=True, CNV=False, armCNV=False, fragProfile=False, report=False, verbose=False, box=True) - inputFolder: str, input fastq file folder path. Setting this parameter means disable fastq1 and fastq2. - fastq1: list, fastq1 files. - fastq2: list, fastq2 files. - adapter1: list, adapters for fastq1 files, if idAdapter is True, this paramter will be disabled. - adapter2: list, adapters for fastq2 files, if idAdapter is True, this paramter will be disabled. - fastqcOP: Other parameters used for fastqc, please see class "fastqc". - idAdapter: Ture or False, identify adapters or not. This module is not for single end data. - idAdOP: Other parameters used for AdapterRemoval, please see class "identifyAdapter". If idAdapter is False, this paramter will be disabled. - rmAdapter: Ture or False, remove adapters or not. - rmAdOP: Other parameters used for AdapterRemoval, please see class "adapterremoval". Default: {"--qualitybase": 33, "--gzip": True}. If rmAdapter is False, this paramter will be disabled. - bowtie2OP: Other parameters used for Bowtie2, please see class "bowtie2". Default: {"-q": True, "-N": 1, "--time": True}. - dudup: Ture or False, remove duplicates for bowtie2 results or not. - CNV: Compute basic CNV or not. This CNV detection funvtion is using the default genome as reference, so no control samples is accepted. - armCNV: Compute basic arm level CNV related values. The arm level cnv detection needs control/healthy samples, therefore only operating function "cfDNAWGS" will get no results in report. This function is designed for case control study in function cfDNAWGS2. - fragProfile: Compute basic fragProfile (long short fragement statistics) related values. This module is not for single end data. The fragProfile detection needs control/healthy samples, therefore only operating function "cfDNAWGS" will get no results in report. This function is designed for case control study in function cfDNAWGS2. - report: Generate user report or not. - verbose: bool, True means print all stdout, but will be slow; False means black stdout verbose, much faster. - box: output will be a box class. that mean the the results can be specified using '.', otherwise, the results will be saved as dict. Example usage: .. code:: python from cfDNApipe import * pipeConfigure(path_to_genomepath_to_output/output threads=60, genome="hg19", refdir=r"path_to_genome/hg19_bowtie2", outdir=r"path_to_output/output", data="WGS", type="paired", build=True, JavaMem="10g", ) res = cfDNAWGS( inputFolder=r"path_to_fastqs", idAdapter=True, rmAdapter=True, dudup=True, CNV=True, armCNV=True, fragProfile=True, verbose=False, )